Días
Horas
Minutos
Segundos

Cosas de La Saga Que Deben Regresar en Los Sims 4



Cualquier fanático que haya jugado las tres versiones anteriores de la saga de Los Sims (o por lo menos dos de ellas) muy seguramente añora que ciertas cosas vuelvan y que otras cosas no se atrevan ni a asomarse en Los Sims 4... Y para los demás que solo han probado la tercera versión, pueden llegar a no conocer algo mejor en el área de SIMulación social y por lo tanto rechazar cualquier cosa diferente a ello que se les llegue a presentar. En fin... Esta entrada es para cualquier tipo de Simmer, ya que discutiré "profundamente" (A Mi Parecer), aquellos Pros de la saga que deben volver... o bien los Contras que deben desaparecer de la faz del Universo Sim.

Puedes agregar algo al artículo si crees que hace falta, comentándolo en el área de abajo.

Atención: Este post fue creado como uno de los regalos de agradecimiento por los 3 Millones de vistas al blog, por lo tanto lo he creado para ustedes :D por eso espero que lo lean (por más largo que parezca), por que lo he hecho con mucho sudor y esfuerzo, pero sobre todo, sudor...

Advertencia: Esta entrada contiene toda clase de opiniones, rumores, especulaciones y "fantasías sin fundamento" sobre Los Sims 4.

(La idea de esta entrada surgió de hacer las caratulas inspiradas en los juegos pasados... aunque entiendo si muchos piensan que soy raro por que lo normal es que hubiese sido al revés :P).


De Los Sims
(Alias "el juego perfecto")


Está claro que la primera versión es la más sencilla pero la más importante por ser la que permitió a la saga hacerse conocer entre los usuarios por primera vez. Y a pesar de ser la más antigua y con menos tecnología, aún, 14 años después, algunas de sus expansiones siguen superando a sus correspondientes en la versión actual. Como dos evidentes ejemplos, SuperStar supera a Salto a la Fama y Magia Potagia supera a Criaturas Sobrenaturales, pero esto no es de ninguna manera debido a las gráficas, si no por la jugabilidad, objetos con acciones, características e interacciones implementados en cada uno de los discos.

  

  

Esto, es exactamente lo que debe volver a Los Sims 4 de Los Sims (1), las expansiones deben incluir muchos objetos especiales e interacciones nuevas que hagan de la experiencia del juego algo increíble y cada vez más amplio y que perdure aún cuando el juego ya sea obsoleto... cosa que con Los Sims 3 no pasó (o por lo menos yo hace rato perdí el interés en él).

De Los Sims 2
(Alias "el juego de PC más vendido de todos los tiempo")

Y los que preguntan... ¿En donde está el Alien de la portada en ingles original? pues aquí está.

Los Sims 2 fue un gran avance para la saga, tanto hablando de gráficas como de jugabilidad, ya que este ofrecía exactamente el balance de las dos cosas y no colocaba una sobre la otra... esto permitió a los usuarios disfrutar del Simulador social como nunca antes, ya que aunque las posibilidades de juego eran amplias y son lo más importante, siempre es crucial que las gráficas estén acorde a lo demás. 

Con Los Sims 2 si podemos discutir más profundamente cada características, ya que aunque salió hace 10 años, está a un nivel similar de calidad y tecnología al juego actual, lo contrario a Los Sims Original.

Para Los Sims 4 han anunciado varias cosas que regresan de Los Sims 2, y es que algo como el 30% de todo lo "nuevo" ya se había incluido antes en la segunda versión, entre ellos las gráficas caricaturescas, las dos barras de relación, las aspiraciones y caprichos, la movilidad inteligente para evitar bloqueos al cruzar puertas, y seguramente otras cosas más que aún no se han revelado (incluso el plumbob del logotipo es casi idéntico). 

Algunos se preguntarán... ¿por que la frase de "volvemos a los Sims de antes"? y ¿por que volver al camino de la segunda generación? pues sencillo, Los Sims 2 es el juego más vendido de toda la saga, y como lo colocamos en el titulo, es el juego para computador más vendido de toda la historia aún después de 10 años de haber salido, entonces es obvio de "Eaxis" tomar este camino después de no haber tenido tanto éxito con la versión pasada.


Además de los detalles que ya están confirmados, a mi parecer debería regresar la posibilidad de crear barrios de una forma sencilla y sin tener que usar una herramienta externa complicada y extremadamente técnica (si, estoy hablando del CAW) ya que aunque esto permitió a los usuarios crear mundos increíbles, no todos los jugadores son capaces de controlarlo (si, estoy hablando de mi). Aunque debe regresar similar a como estaba presente en Los Sims 2, es obvio que debería ofrecer notables mejoras, como la posibilidad de posicionar todas las carreteras al gusto, editar la estructura del terreno en pequeña medida, y cambiar el ambiente (color del cielo, del terreno y del agua). Aunque muy seguramente no podría ser implementado igual de "potente" al CAW dentro del juego por que afectaría el rendimiento, y por lo tanto no sería mala idea tener un "Crea un Mundo" externo pero con herramientas mucho más fáciles de usar, para que todos tengamos las mismas oportunidades de crear barrios personalizados. (Hay rumores de que en Los Sims 4 se añadirán herramientas "intuitiva" para crear barrios, pero no es nada confirmado oficialmente aún). 


 Sin duda, de Los Sims 2 también deben regresar los pequeños detalles (de urgencia), el no teletransportarse a todos los lugares, el abrir la puerta del carro y salir con él del garaje o la zona para parquearse, el preparar alimentos usando los estantes y la alacena y que estos no sean solo decorativos, el tomar los objetos con animaciones apropiadas y que no se vea como que ha aparecido por arte de magia si no que ha sido recogido por las manos del Sim, entre otros detalles similares que son los que ayudan a disfrutar aún más el juego y a que la simulación sea más realista... y además esto nos haría amar mucho más Los Sims 4.

 En Los Sims 4 está confirmado que no habrán tantas madrigueras como en Los Sims 3, por eso sería esencial que como en Los Sims 2, hayan todo tipo de locales abiertos, incluyendo librerías, tiendas, supermercados, cafés, restaurantes, pero todo esto desde el juego base y no por obra y gracia de la Store...


 Las divertidas cinemáticas que aparecían en el juego base de Los Sims 2 sin duda le agregaban emoción a cada primera vez que practicabas algo... primer beso, primer ñiqui-ñiqui, etc. Por eso sería estupendo que Los Sims 4 lo agregará con mejoras, ya que haría que la conexión jugador a Sim fuera aún más estrecha.



 El ambiente cómico siempre ha sido tradicional en Los Sims desde la primera versión, y es que mientras juegas siempre surgen escenas o situaciones que "te parten"... tristemente en la versión pasada esto no estuvo muy presente, por lo que sería genial que la irreverencia y locura de Los Sims 1 y 2 volviera en Los Sims 4.


 Otro detalle que además es muy pedido por los fanáticos son la imagen y las interacciones que tenían los bebés en la segunda versión, y es que a parte de que no parecían orugas ya que tenían piernas, los Sims eran más conscientes y podían pasar el bebé a otro Sim y no necesariamente los dejaban por el piso.

 El estilo de música de Los Sims 4 debería ser muy similar al de Los Sims 1 y 2, ya que aunque la música de los menús de Los Sims 3 fue buena, no se compara con la música que ofrecían las otras versiones.

 La rapidez de cargo al abrir el juego, el lanzador o al guardar una partida debe regresar. En Los Sims 3 este sistema es algo complicado y puede tardar muchos minutos en terminar el proceso, lo que en realidad es, simplemente ¡Estresante!

 ¡Queremos Aliens en el juego base!


 Y por ultimo... ¡Queremos Abren Negocios! (aunque sobre esto ya se ha declarado el "querer trabajarlo" en Los Sims 4 por "SimGuruGraham").

Seguramente hay muchas más, pero no puedo pasarme tanto en texto (aunque creo que ya me pasé).

De Los Sims 3
(Alias "la oveja negra de la familia" :P)


¡Bueno, y hemos llegado al nudo de la historia! No quiero quitarle ningún "cerdito" a Los Sims 3, ya que aunque como dije antes es para mi "la oveja negra" pude disfrutarlo mucho y además agregó desde el juego base herramientas y características muy novedosas como el barrio abierto, el crea un estilo, los rasgos, los estados de humor, las gráficas avanzadas, un CAS mucho más personalizable, por primera vez diferentes tonos de voz, paisajes hermosos del mundo, arquitectura más avanzada, y... ¡las madrigueras!¡los bugs!¡el error 1, 2, 3, 4, 5, 6....15...100!¡Los Sims 3 no responde! entre otros... *se calma*. Por lo que nombraba antes, para que un juego funcione bien (de acuerdo a lo que yo pienso) debe tener un balance en gráficas y jugabilidad, si no, pasa lo que pasó con la tercera versión... que todo se ve realmente genial, pero como muchas personas con computadores avanzados afirman -"no es posible jugarlo perfectamente aunque se tengan características de sistema de sobra"- (yo no lo afirmo, por que mi tarjeta de vídeo es horrible :D). Esto también es debido a que como muchos saben, Los Sims 3 se hizo de afán y se lanzó de afán, dejando muchos, muchos bugs (aproximadamente 150.000 - dato de Rincón del Simmer) que debían arreglarse y que muchos, después de 5 años no se han arreglado aún, y no se arreglarán... ¡jamás! En fin.


Se han confirmado varias cosas de Los Sims 3 que se encuentran actualmente en Los Sims 4, como los rasgos, los tonos de voz diferentes, los estados de humor, los mismos estados de vida, eventos del trabajo para realizar fuera de la oficina (similares a los de Los Sims 3 Triunfadores), los recuerdos (que serán mucho más avanzados ya que repercutirán en las emociones en el momento de obtenerlas y después al recordarlas) y seguramente otros aún no revelados.

 De Los Sims 3 por supuesto tiene que volver el mundo abierto, y aunque esto no se ha confirmado oficialmente, por lo que se ve en las imágenes oficiales es seguro que si regresará en un 99.99%. No creo se deba aplicar alguna mejora al mundo abierto, a parte de hacerlo más poblado y vivo, ya que los alrededores de los barrios de Los Sims 3 se ven como uno de esos pueblos en donde se practica el lanzamiento de bombas nucleares.. desierto o con maniquís estáticos sin emociones (mala broma). También, como se mencionó en la revista oficial de España, habrán muchas más cosas que hacer en los alrededores y se cree que esto si es cierto ya que al parece tendremos bares y museos desde el juego base (Guía Prima). Para mi, el tamaño de los barrios puede llegar a ser igual al de Los Sims 3 (tal vez un poco más amplio) pero con que tenga más vida en todos los sentidos me conformo.


 Aunque se ha confirmado que el "Crear un Estilo" o CASt no estará incluido en Los Sims 4, en una de las muchas entrevista del GamesCom del modo construir, SimGuruHouts afirmó que "no estará presente de la misma forma"... y a mi parecer, esa parte que he resaltado significa que aunque no será como lo conocemos, de una u otra forma estará, lo que me hace pensar en la posibilidad de tener una clase de herramienta externa como el "Taller de cuerpo" de Los Sims 2, combinado con el CASt de Los Sims 3... ¿acaso es pecado para un Simmer soñar tan alto?


 Debería incluirse la posibilidad de nadar en el mar desde el juego base, ya que es algo muy básico, y que en Los Sims 3 se implementó muy tarde.

 A mi parecer la expansión (que no es obligatoria de incluir por parte de Maxis) y que debe volver en Los Sims 4 es "Aventura en La Isla", por otro lado "Hacia el Futuro" fue un concepto interesante pero si llega a incluirse en la cuarta versión debería estar la posibilidad de viajar al pasado también. Como algo aparte, a mi parecer "Menuda Familia" no debe repetirse, y todas las características de ésta deberían ser incluidas en el juego base.


 Por ultimo, tocamos el tema de... La Store, aquella tienda de Los Sims 3, en donde se venden conjuntos más caros que un disco de accesorio y que le quita protagonismo a las expansiones por estar incluyendo objetos "premium" que debieron incluirse en un disco especifico, como la estación de olas que debió estar en "Aventura en La Isla" (y otros más). Si llegara a existir la tienda o Store de Los Sims 4 (claro que existirá) debe tener objetos que no puedan incluirse en ninguna expansión, por que tienen temática muy a parte... con esa excusa sería aceptable, pero la mayoría del contenido deberían ser objetos básicos con temáticas variadas, para dejarle el tema de objetos con interacciones solo a los discos de complemento.

Y no se si tengo la mente bloqueada, pero no se me ocurre otra cosa destacada que haya sido introducida en Los Sims 3 y deba volver a Los Sims 4.


¿Que deseo ver en Los Sims 4?
(Los Sims 4, Alias "el salvador de la saga")

Esto es un concepto de la caratula creado por mi, es inspirado en el trailer "La Llegada" (el final).

¿Por qué lo considero el salvador de la saga? por que si llegara a ser un fracaso, podría significar el final de Los Sims! así que de esta versión depende de si habrá un "Los Sims 5" en algún futuro.

Hasta ahora estoy muy emocionado con esta entrega, y eso que solo han compartido "un pequeño fragmento" de lo que será el producto final, así que supongo que me infartaré cuando conozca todo lo demás. Lo siguiente es lo que espero que incluya el juego, que no ha sido desmentido, nombrado o confirmado y que es ciertamente posible... digo, no voy a pedir reconocimiento facial en el CAS... no aún :P.

Fantaseando

 Se que se ha confirmado que no habrá modificación de la altura en el CAS pero ¿y si los Sims crecieran progresivamente durante las diferentes etapas de vida hasta llegar a la altura normal? Me parece extraño que aún no se haya comentado nada sobre las demás edades, y como Simmer positivo, considero esta posibilidad hasta que sea negada... además si los Modders pudieron crear este efecto con un algoritmo en Los Sims 3, ¿por que los desarrolladores profesionales no lo harían en un juego nuevo?


 La revista oficial de España había declarado varias cosas, entre ellas el crecimiento y movimiento del cabello y la barba, esto nunca fue desmentido específicamente (solo se dijo que habían errores de traducción pero nunca se especificó que, y tampoco retiraron el articulo de la revista en la pagina de EA) así que me encantaría que a parte de crecer y moverse ligeramente, hubiera un slider para el largo del cabello, que funcionaría con el mismo mecanismo de crecimiento así que no sería esfuerzo adicional si éste sí fuera real.


 Un modo en linea es más que necesario para Los Sims 4... cada vez son más los juegos que lo incluyen de alguna forma y es que un gran porcentaje de los usuarios desean algo de este tipo. A mi parecer un modo cooperativo en donde se comparta con amigos en un mismo mundo sería estupendo.



 Hay rumores de que Los Sims 4 incluirá tres diferentes barrios... esto sería genial, ya que es limitante contar solo con una opción.

 Otra cosa sería viajar de barrio en barrio como si fuera un destino turístico desde el juego base (esto si el anterior punto se cumple) ¡sería genial! eso incluiría amistades extranjeras, y conservar los amigos aún cuando nos mudemos. Esto también aplicaría con los lazos familiares... imagínate ir a visitar a tus abuelos a la ciudad vecina y quedarse allí por un tiempo limitado ya sea en la casa del familiar o en una posada.

 Con esto podría surgir también una mudanza entre barrios mejorada, en donde los Sims no pierden nada de información. Al completar el proceso, llegarían por las fronteras de la ciudad a la que se están mudando ya sea en un taxi, en el tren o el auto propio.


 Las pantallas de carga deberían desaparecer (a excepción de la principal del juego). Me explico, al hacer un viaje a un destino turístico podríamos ver el interior del carro, el tren o el avión en donde los Sims están haciendo el viaje, obviamente la carga del juego estaría oculta detrás de las escenas mostradas, pero sería una forma más entretenida de esperar mientras se carga el destino (sé que esto puede afectar el rendimiento, pero por eso la sección se llama fantaseando...)

 La nave espacial mostrada en el trailer de jugabilidad siempre me ha parecido misteriosa... eso junto a la pista escondida en el trailer de llegada de un astronauta bailando, lo que me hace pensar que ir al espacio, ya sea en un mapa reducido sería genial, esto incluiría que la criatura sobrenatural del juego base fueran los alienigenas (creo que con esta fantasía me pasé XD).


♦ ¡Un modo diferente de controlar a nuestros Sims! Si alguno ha jugado las versiones de consola de Los Sims, supongo habrán usado el modo de primera persona, en donde se controla el personaje sin tener que hacer clic en alguna parte para que camine si no usando flechas o un análogo, obviamente esto con la posibilidad de alejar la pantalla tanto como se desee, y cambiar entre modos de una forma fácil.

Las expansiones en Los Sims 4 deberían estar conectadas cada vez que salga otra nueva... por ejemplo, si sale una expansión de magia, que se agreguen pociones de características de complementos pasados y que luego se incluyan más pociones a los complementos futuros. Esto podría aplicar con varias temáticas que aún no se me ocurren...

¡Y esto fue... Fantasías!

The End



Puedes agregar tu "fantasía de Los Sims 4" abajo en un comentario.
Puedes visitar PekeSims para más "Fantasías de Los Sims 4".

(Vuelvo y repito para evitar problemas)

Advertencia: Esta entrada contiene toda clase de opiniones, rumores, especulaciones y "fantasías sin fundamento" sobre Los Sims 4.

Juan Gärtner

Simmer de toda la vida. Fan de Tomb Raider. El azul es el nuevo negro. Larga vida a Los Sims 2, ¿Los Sims 4 Who? Estudiante de diseño gráfico.Originario de Bridgeport pero ahora vivo en Oasis Springs. l Oh Feebee Lay! Amante de SuperStar, Magia Potagia, Abren Negocios, Criaturas Sobrenaturales, Al Caer La Noche y Aventura en la Isla. Los packs de contenido son todo lo que las expansiones quisieran ser.

124 comentarios:

  1. Los sims 3 no debe tener demasiados bug- 150 MIL!?!?!?!?!?!
    QUÉ DEMONIOS TE PASA EA!? Y yo muy quejoso por dejar solo un bug en Game Dev Tycoon :P Concuerdo en ABSOLUTAMENTE TODO LO QUE HAS DICHO, pero, que se cumpla, es otra cosa, y es muy poco probable :c
    Lo que más amo, y espero de la "zona fantaseable" (patente en trámite) es lo de poder viajar a otros barrios y visitar amigos y/o familia, y más me gusta eso de una cinemática del coche, avión, barco, etc. Aunque sea sería genial que fuese una imagen pero con tus sims y otros que se generen aleatoriamente (si es en algún transporte público y eso) Te odio Juan por hacerme enloquecer por estás cosas que son muy poco probables :'c Ah, y también espero alguna expansión al estilo Abren Negocios. Toma nota de todo esto "Eaxis" (patente en trámite).

    ResponderEliminar
    Respuestas
    1. ajajajaja me dio mucha risa tu comentario! lo siento, a alguien le tenía que tirar la pelota para que se sintiera igual, y ahora se la he tirado a unos cuantos cientos (sobre lo de la pantalla de carga y viaje a otros barrios) XD pero igual, no es tan imposible supongo, tal vez si se le twittea la idea a Graham pueda haber una posibilidad de 0.01% :/
      También jugué Game Dev Tycoon, y nunca dejaba ni un bug :P

      Eliminar
    2. Yo dejaba bugs cuando estaba todo bien y cuando justo apretaba "terminar" salía un bug de la nada :c.
      #PorUnSims4ConPantallasDeCargaDisimuladas demasiado largo :c

      Eliminar
    3. Hay que twittearlo o hacer un hashtag (en ingles y más corto, claro) y pasarlo por blogs y foros famosos hasta que al menos respondan :P

      Eliminar
    4. Lo de la cinemática no es tan imposible, ¡ya lo hicieron en Los Sims Toman la Calle de PS2!
      Y la verdad me ha gustado mucho esa idea de poder ir a visitar a parientes que vivan en otro barrio. xD

      Eliminar
    5. Es una fantástica idea la de las pantallas simuladas y viajes entre barrios!
      yo siempre eh querido poder mudar a mi sim de sunset valley a starlight shores y mantener los lazos familiares y amigos, aunque sea poder llamarlos (cosa que se permitía en los Sims 2 Universitarios pero no en Sims3) y ademas una cosa que seria genial para viajar entre mundos (fantasía mía) es que haya en mas o menos lo límites del mundo un aeropuerto o muelle donde tomar un barco al barrio elegido y que allí aprezca una especie de 'pantalla de carga simulada' donde se vean videos generados de tus sims haciendo algo en el transporte elegido, por ejemplo: leyendo o viendo emails en una tab, (si se trata de un avion) algo semejante si es metro, y si es barco situaciones en el camarote o en una piscina (si es crucero) o cosas así y que justo cuando se termina de cargar la animación pase como a una donde se vea donde se levantan o se les anuncia el fin de viaje y luego aparezcan fuera del muelle, estación o aeropuerto siendo estos madriguera... Si ya se sueño muy alto pero con soñar no se pierde nada =(

      Eliminar
    6. Y una de mis fantasías favoritas es algo que había en Los Sims 2 consola y eran los minijuegos, aquellos minijuegos mientras cocinabas y si talv ez sea algo tedioso y aburrido pero si detienen el tiempo durante algún tipo de minijuego que te permite interactuar mas profundo en las acciones de tus sims (si ya se a nadie le gusta esa idea pero a mi me gusta soñar <=) y otra para una expansion es una relacionada con deportes de todo tipo pero bien hechos.

      Eliminar
    7. Oye yo hablo un poco de ingles le puedo mandar tweets a ellos diciendoles las cosas y eso pero dudo de que vean mis mensajes

      Eliminar
    8. Emm., como todos dicen sus sueños o opiniones, diré las mías también, en los sims 2, podía mandarle al sims como a "servir la mesa", y colocaba todos los platos para los sims que estaban en la casa, en los sims 3 al principio lo hacian, pero despue no se que paso, que cocinaba y dejaba el plato grande y dejaban que los demas sacaban, era algo triste para mi :C, le daba un toque familiar al tema.....y ahora me acorde que con una amiga hablamos de los que debía mejorar en la saga y ella me dijo que le gustaría que se viera como la comida se va terminando de apoco, XD jajaja, como cortando el salmón y luego el puré LOL :) bueno eso.

      Eliminar
  2. ''Y esto fue fantasías'' jajajajajaja..me mató XD...pero si pido por las animaciones de las puertas de los carros... y las cinemáticas que hacían que la primera vez fuese algo especial <3

    ResponderEliminar
  3. Si la mayoría de esas cosas regresaran a el juego, yo creo que se podrían disfrutar mas si agregaran "Ajuste de tiempo", si en los Sims 3 se permitía el ajuste de edad en los Sims ¿Porque no el ajuste de tiempo? Yo creo que una de las primeras razones por las cuales me "Cansa" el jugar con los sims, es por el poco tiempo que te da el juego.

    Para estar acorde al tiempo, tengo que levantarlos a las 3:00 am, para poder ordenarles que se bañen, duchen y coman, se hacen las ocho y se van.
    Vuelven a las 15:00/13:00 (depende) el adolescente esta aburrido, pero tiene que hacer la tarea, hace la tarea, ve la tele, tiene que hablar, habla, y despues de todo eso se hace tarde 12:00 de la noche, se levanta a las 7:00 no durmió bien, tiene sueño, esta sucio, tiene hambre, quiere ir al baño... y este es uno de los ejemplos, porque tengo muchos

    AGRADEZCO, que hayan sacado "Comodidad" y "Entorno" y que les den de comer en el colegio, pero aun así no se puede disfrutar "Mundo libre" de Los Sims 3, porque los sacas a pasear y se te ponen "rojos", y esto me viene pasando desde "Los Sims Primera cita" hasta el dia de hoy, y ojala que el del "Saxofon" o "Giuseppe con su mono", no me bloqueen la entrada al edificio porque tiro mi computadora a la mierda (jaja)

    ResponderEliminar
    Respuestas
    1. Totalmente deacuerdo. Es un fastidio, no te da tiempo de nada, y mas los atascos que siempre hacen que se queden 3 minutos (equivalente a 3 horas en el juego) haciendo el tonto. Tuve que recurrir a un mod que aumenta la duración del dia (eso o el truco para subir las necesidades) para poder jugar -.- .. ¡que arreglen esto, porfavor!

      Eliminar
    2. Concuerdo contigo Gonzalo mi mayor estrés en Los Sims siempre ah sido que los minutos de juego sean segundo en la vida real pero que las acciones duren tanto en cumplirlas, tal vez si los minutos de juego fueran 15 o 30 segundos del tiempo real o incluso menos con 10 segundos seria una gran ayuda, (pero obvio que no nos hagan mas larga la duración de las acciones como pasa en Los Sims Free Play que como es a tiempo real duermen por 7 horas reales y se bañan en 1 hr real!!!)

      Eliminar
    3. No me acordaba de ese dato, y la verdad es que me gustaría mucho que lo implantaran.
      De hecho alguna vez jugando a Los Sims 3 he pausado el juego y he buscado en Internet si habían mods o trucos para poder cambiar el como transcurre el tiempo (pero no he dado con ninguno).
      Hace poco instalé de nuevo Los Sims 1 y yo de pequeña recordaba que todo me iba más lento, pero ese día se me hizo todo muy corto.
      Donde más se nota supongo que es en Los Sims 3, ya que algunas acciones tardan eones en completarlas, hay veces que se tiran 2 horas comiendo y los tienes que alimentar como mínimo 3 veces al día, luego otra media vida duchándose. Es una bestialidad, para hacerlo más ameno hay veces que tengo que tirar de trucos, porque si por mis sims fuera se ducharían, irían a clase/trabajo, comerían, echarían la siesta, se ducharían, comerían y dormirían; con trucos al menos puedo mandarlos al parque o cosas así (y todavía cuesta).
      Es más a veces por el tiempo que tardan en completar la acción que por el tiempo en el que transcurre el juego.

      Eliminar
    4. Lo que pasa con lo del tiempo, es que en el 3 todo era muy lento y con mucho lag, en cambio en el 1 y el 2 era fluido y alcanzaba el tiempo! si hacen el juego rápido de nuevo, entonces no habrá necesidad de cambiar el tiempo. Igual, parte del reto en el juego es hacer todo lo de un día en ese tiempo.

      Eliminar
  4. Con respecto a lo de Controlar a los Sims como en Los Sims 2 de las consolas, es una que yo creo que combinaría muy bien con la idea de jugar cooperativamente.
    Aunque ahí prefiero que en vez de jugar en Servidores, yo pueda crear mi propia partida Lan vía hamachi con amigos con alguna familia ya haya creado anteriormente, la idea me parece estupenda!
    Innovaría mucho al juego de PC y seria muy divertido, tan solo falta que se pueden manejar los autos así se ahorran en las "Teletransportaciones"

    ResponderEliminar
    Respuestas
    1. Estoy de acuerdo! queda muy bien.
      Si, lo de no tele-transportarse a todos lados es algo esencial para esta nueva versión.

      Eliminar
  5. Excelente entrada, leyendo me trajo una nostalgia y a la vez miedo. Tengo miedo de que estas personas sigan cometiendo estupideces con tan buen juego y prácticamente único en su género, dejarlo "extinguir" por negligencia. No me imagino un mundo sin los sims y que juegos repetitivos como call of duty sigan saliendo por año y "todo el mundo" adorando.
    Sobre tus fantasías, no las veo tan imposibles, de hecho no lo son. Sé que muchos van a decir "no compares" "ese es otro juego", pero por Dios, otros juegos tienen cosas mucho más complicadas que muchas de las cosas que pedimos y sin embargo lo hacen y son excelentes, por ejemplo GTA V, wow cuando lo juego me pregunto como hicieron todo eso, que debió ser difícil, que se debieron esforzar mucho, pero lo hicieron y es excelente. Entonces por qué ellos no pueden darnos una obra maestra como los de Rockstar ? incompetencia ? están relajado porque no tienen competencia? o simplemente tal vez el presupuesto, es lo más lógico que encuentro.
    Sobre el modo online, es algo que DEBE DE ESTAR CASI OBLIGATORIAMENTE. Al parecer ellos todo lo que hacen lo hacen de una sola forma; o es offline o es online. Por ejemplo Simcity (la última entrega) que les costaba hacer un modo offline ? (ahora están trabajando en un parche que da esta opción) ya sé que el juego está "diseñado" para interactuar y toda la cosa, pero y si no tienes internet ? y si no te gusta jugar online? sí, vas a tener un juego inservible. No hay justificación alguna para que no hayan puesto un modo offline desde el principio. Volviendo a los sims, como dije anteriormente; eso es algo que manda. En estos tiempos casi todos los juegos tienen un modo cooperativo, eso es lo que más llama la atención ahora en un juego; poder jugar con tus amigos (por eso creo que call of duty y esos juegos repetitivos tienen tanto éxito, porque te dan la opción de jugar con tus amigos y extraños e interactuar y hacer el juego más vivo, divertido y no sentirte solo en una fría habitación). Pero como dije anteriormente, ellos o lo hacen de una forma o de otra. Ya ves que el juego iba a ser totalmente online, cosa que estoy casi seguro de que lo "tiraron a la basura" por lo que pasó con simcity (y gracias a Dios, porque hubiese sido una gran decepción y una bomba nuclear que hubiese acabado con el juego).
    Sí, admito que no me simpatizan mucho los que están detrás de los sims, aveces los siento algo prepotentes, mediocres, inútiles,incompetentes, etc (no, no los insulto, es la verdad) porque hay cosas que hacen o que no hacen que simplemente dan mucho de que hablar y de que quejarse porque a estas alturas no deberían de salir con pendejadas como las que ellos salen (no va a faltar el fan conformista que me venga a decir del mal que me voy a morir y que haga yo el juego. Pero somos los usuarios, los consumidores a quienes ELLOS LE HACEN EL JUEGO , por quienes ellos están ahí y tenemos derechos a quejarnos y a pedir algo con más calidad y menos mediocridad, que se ve a leguas en los sims 3 y que solo querían sacarnos nuestro dinero de una forma pendeja) en fin, aquí lo voy a dejar porque si no... uff no me callo; porque tengo tantas cosas que decir que en todo lo que eh escrito siento que no eh dicho nada aun, hahaha.

    ResponderEliminar
    Respuestas
    1. Cuanta razón en TODO lo que has dicho... No podría estar mas de acuerdo contigo. Mira que yo soy un gran fan de la saga y actualmente sigo jugando a los sims 2 con los hijos de los hijos de los hijos de mis sims, pero es que con la joya que hicieron con los sims 1, el estropicio que han hecho con los 3 (y su store). Alguien debería crear otro juego de simulación social a ver si así se ponían las pilas de una vez y se preocupan mas por crear un producto mejor que por crear formas de sacarnos todo el dinero posible...

      Eliminar
    2. Estoy de acuerdo!, tenes razón en todo. Pareciera que la gente no se da cuenta de todos los errores que tiene el juego, se la pasan diciendo cosas positivas nomas.

      Eliminar
    3. Si estoy de acuerdo. Siempre me pregunte ¿si es el juego mas vendido de la historia, por que es el unico y no sale otro a hacerle competencia? es extraño.
      Por esa razon creo que se relajan y no se esfuerzan demasiado ( alguno discos de accesorios y expanciones fueron un robo, con muuuy pocos objetos o cosas que tendrian que haber puesto en el juego base) pero nosotros con nuestras ganas de darle un respiro nuevo a nuestro juego ahorramos y los compramos unos tras otro (se que la pirateria esta mal... pero en algunos casos me digo "esto no vale lo que pague" MENUDA FAMILIA!!!) = me gusta mucho el juego haci que lo seguire comprando almenos hasta que salga alguno de la competencia que este mejor.

      Eliminar
    4. No es el juego más vendido de la historia! XD. Creo que es el juego más vendido de EA (Los sims 2, no LS3). Es simple.. para qué correr el riesgo de lanzar un juego de simulación que no es muy probable que tenga éxito.. Los sims es un juego para cierto público.. La mayoría de gamers pasan del título y los jugadores de tiempo parcial no invierten mucho dinero en el, los que más influimos en el exito de Los Sims somos nosotros, los fanáticos.. Los que estamos desde sus comienzos o los que comenzaron un poco tarde pero les atrae la saga.. para qué vendernos un juego completo, almenos fluido, si nos venden una chorrada de juego lleno de bugs, igual se lo compraremos.

      Eliminar
    5. Tienes toda la razón Lexx, ya te lo había dicho por FB! Considero que hay fanáticos, y fanáticos ciegos, que son los que no ven ni un error en las cosas que les gusta! y hay que reconocer que Eaxis hace cosas buenas pero cosas malas también.

      Ultimo anónimo: No es el juego más vendido de la historia, es el juego de PC más vendido de la historia (Los Sims 2 con 20 millones sin Expansiones), y Los Sims es la saga de PC más vendida de la historia, como lo dije en el post.

      Eliminar
    6. Yo adoro la saga, aunque solo haya jugado el uno y el tres. Espero que EA no mate tal saga.

      Eliminar
  6. Deberían poner en Los Sims 4,todos los peinados y ropa beta que no pusieron en Los Sims 2...francamente,eso es lo único que me decepcionó de la segunda generación

    ResponderEliminar
  7. A mi me gustarìa también que regresaran las enfermedades. En los Sims 2 podìan quedarse enfermos y si después de 10 dìas todavìa estaban enfermos morirìan. En los Sims 3 no habìa, y ponìa realismo. Respondeme porfavore.

    ResponderEliminar
  8. ¡Estoy muy de acuerdo en todo lo que has dicho! Y seguro que más gente también.

    No estaria tampoco mala idea como dices que en las pantallas de carga fueran así como un video de como viajan mientras se carga (?)

    ¡Es que no falto ni un detalle de lo que yo pensaba! Por eso me gusta mucho este post.

    Yo quiero un Sims 4 Magia Potagia quiero que incluyan todo de Magia Potagia más las expansiones de Los Sims 2 y Los Sims 3 Criaturas Sobrenaturales + a parte de la saga new. Me molesto demasiado que pusieran los dragoncitos en la Store y no en la expansión.

    Bueno no voy a repetir cosas que yas has dicho tu Jajaja ^^ Buen post! Sigue así Juan!

    ResponderEliminar
    Respuestas
    1. M cabuen en toh! Y lo peor es que lo que ha dicho solo incluira la mitad o menos.
      Buaaaaaaaaaaaaa!!!!!!!!!!! Que lo lea alguién y lo haga realidad m cabuen!
      >;(

      Eliminar
    2. Gracias Paula!!! una combinación de cosas de toda la saga en la expansión de la misma temática sería épico, y es probable, ya que según aquellas pistas del trailer están trayendo mucho de los juegos pasados.

      Eliminar
  9. Gran trabajo me gusto mucho la noticia y como yo y todos en verdad t damos las gracias, porq ya que EA no dice nada tu estas a la semana al pie del cañon y eso mola!! Y con respecto a Los Sims 4 yo pienso q va a ser Los sims 2 mejorada con lo bueno que tubo Los Sims 3 y... nada q gran trabajo y sigue asi!! :))

    ResponderEliminar
    Respuestas
    1. Gracias :D si, el 4 debe ser una combinación de todos los juegos pasados quitando lo malo obvio :P imagínate que el 4 tuviera lo malo del 3! dios... XD

      Eliminar
  10. algo que deben agregar nuevo en los sims 4 son las costumbres. Por ejemplo: que en el CAS se eligieran las costumbres del sims y piedas elegir como que un sim desde que se levante arregle su cama o que antes de dormir siempre se de un baño, eso estaria muy bieno si lo agregaran en los sims 4

    ResponderEliminar
  11. tambien debe haber una opcion de lavar tu auto. Que si andas mucho por la ciudad se te ensucie y tengas que lavarlo o que en la ciudad hallan car wash

    ResponderEliminar
  12. deberian tambien agregar mas objetos para los bebes e infantes como la silla de carro para poder viajar en carro con los bebes y cosas asi

    ResponderEliminar
    Respuestas
    1. Podrías dejar de hacer tantos comentarios y decirlo todo en uno solo? Por favor :P

      Eliminar
  13. tambien deberian agregar tareas mas largas o diferentes para los niños y adolecentes, como que le dejen a los sims niños y adolecentes maquetas, cartulinas o que le pongan una tarea investigando en la pc, etc. Tambien deberian haber mochilas y loncheras y no que vallan sin nada al colegio

    ResponderEliminar
  14. tambien deberian agregar los permisos. Que los niños no anden como huerganos por la ciudad que le pidan permisos a sus padres para salir al parque o a la casa de un amigo y tambien permisos para los adultos que le pidan permisos a los jefes para salir de su trabajo mas temprano por diferentes razones como que su hijo se enfermo y cosas asi. Tambien deberian agregar los castigos para los niños y adolescentes que hagan travesuras.

    ResponderEliminar
    Respuestas
    1. Creia que era yo pesada ya que comento cada post...
      Pero tú ._. ponlo todo seguido.

      Igualmente todo lo que dices ya lo saben los creadores -.-
      son cosas de la vida real, cosas cotidianas...
      Pero que algunas tonterias hacen más pesado el juego...

      Excepto algunas.

      Eliminar
    2. Lo de los castigos ya estaba puesto de alguna manera en LS3. Cuando los hermanos se peleaban, el padre podía elegir la opción "mandar al rincón" o algo así xD.

      Eliminar
  15. Fantasia 2000 jajaja. Ojala pusieran todo eso, los sims 2 fue el mejor de los 3 y tendria que hacerse un hibrido de los sims 1 y 2, el Menuda Familia fue una expansion con bastantes cosas basicas, el carrito, el aprender a conducir a menores, las graduaciones... Eso tiene que estar en el juego base, y la Store... FUS FUS, no te queremos

    ResponderEliminar
  16. creo que en los sims 4 podrian aser muchas mas cosas sabiendo que estamos en el año "2014" y que hay juegos que son tan realistas en las graficas, creo que podrian aser muchas mas cosas como de entrada ponerle el clima y las mascotas. creo que eso sinceramente lo pueden aser sabiendo en esta va aser la cuarta saga de los sims.
    hay en algunas cosas que decepcionan ( uno de los ejemplos, porque tardan tanto tiempo en crear un juego, con el tiempo que tiene puede agregarle el clima, mascotas, altura etc. )
    estaria bueno que en esta saga pongan cosas de los sims 1 2 y 3.
    y creo que los simgurus tendrian que salgan a responder.

    ResponderEliminar
  17. para mi a los sims 4 los están haciendo desordenadamente y apurados
    como ejemplo el twit de que si lograban terminar el juego antes de la fecha indicada iban a agregar mas cosas al juego. Yo creo que se tendría que agregar, si se puede perfeccionar hasta el limite, si no les alcanza el tiempo para agregarle todo y perfeccionarlo al máximo estirar al tiempo necesario se 1 año mas, un mes o dos semanas en ves de hacerlo a medias porque no les alcanza o alcanzo el tiempo
    Siento que va tener muchas fallas y va a ser una copia de los sims 2 y un poquito del 1 (espero fuertemente equivocarme) simplemente xq están haciéndolo en un momento critico de EA

    ResponderEliminar
    Respuestas
    1. Con ese twitter querian decir (creo) que ya tenian casí todo terminado así que si lo terminan añadirian más cosas pero no adelantarian la fecha de lanzamiento.

      O sea que han tenido un buen tiempo ya que además se estaba desarollando desde hace tiempo.

      Eliminar
    2. Siento que va tener muchas fallas y va a ser una copia de los sims 2 y un poquito del 1 (espero fuertemente equivocarme)''

      De ser así, creo que la mayoria de Simmers pegariamos el grito de alegría. Eso estamos pidiendo, eso queremos.
      De cualquier modo, concuerdo con lo que dices del la organisacion y tal.

      Eliminar
  18. De acuerdo 100% me encantaría que los sims4 nadaran en el océano
    -Existiera el "Taller de cuerpo" para crear pieles y re-colorear ropa fácil
    -Pudieran hacer yoga como en LS2
    -Que existiera una opción para editar el mundo y aunque sea dejara alisar alguna parte del barrio (en casi todos los mundos hay muchos desniveles donde no se puede colocar nuevos terrenos.
    -siempre me molesto que en Trotamundos no hubiera una estación de tren o aeropuerto (madriguera) y que los sims tengan que ir ahí para viajar.
    -Abrir puertas de los autos y dar marcha atras.
    -Las cinematicas eran fantasticas (mi favorita: la del niqui-niqui en el jacuzzi)
    -Tenes estaciones o mascotas (aunque sea perro y gato) en el juego base ¿es soñar demasiado?
    -El sistema de romance sea mas inteligente (celos)
    -Comprar ropa y cambiarse solo en el armario (salvo ponerse ropa interior uno puede ponerse en ropa interior en cualquier lado XD)
    -Chaquetas y abrigo como accesorio
    -Poder planear un vestuario para toda la semana y que nuestro sims lo cambie automáticamente según pasan los días.
    Gracias me encanto esta entrada son los mejores Juan y sims soul mi pagina de información favorita

    ResponderEliminar
    Respuestas
    1. Coincido con lo que dises.

      Eliminar
    2. Gracias Taylor, me encanta que te haya encantado :P
      Lo de las estaciones y mascotas, con EA si es demasiado soñar :( más que lo han anunciado ya como no incluido.

      De resto me encanta todo! lo de las chaquetas lo deben hacer en esta entrega, es algo muy básico, no entiendo por que siempre los colocan juntos.

      Eliminar
  19. porque tiene que salir en setiembre de 2014 estamos recien a marzo que tiene el juego 70 juegos en 1 estoy desconforme con la fecha de lanzamiento y vuelvo a preguntar esto ¿que tiene el juego "the sims 4"

    ResponderEliminar
    Respuestas
    1. Desde cuando el juego tiene que salir enseguida de su anuncio? :l

      Eliminar
    2. Sale tarde por que EA lo ha retrasado, pero ya hubiera salido a estas alturas de no ser por sus problemas económicos, de todas formas el retraso nos ha beneficiado, ya que el juego quedará mucho mejor ahora.

      Eliminar
  20. Quisiera volver a trasladarlos de barrio o mundo sin perder la genealogía y si se puede que se enfoquen en la genética. Integrar la saga SimCity con Los Sims fue genial.

    ResponderEliminar
  21. Me gustaría que existieran tres barrios como en Los Sims 2, y NO me gustaría que pase lo que pasó en Los Sims 3, me refiero a que en Los Sims 2 por ejemplo, entrabamos a Vista Gentil, y desde ahí seleccionábamos nuestra casa, no como en Los Sims 3 que cada barrio era una partida distinta y eso no sucedia en Los Sims 2. No se si me explico.

    ResponderEliminar
    Respuestas
    1. No te entiendo puedes explicarlo de otra forma????

      Eliminar
    2. Entonces algunos que tengan varios personajes no podrían crear más ya que el mundo estaría creado de un mogollón de personajes del jugador nose si me entiendes.

      Tampoco además es que sea malo ya que en Los Sims 3 podías igualmente entrar a la misma partida y crear en ese mundo otro Sims. Y cambiar cuando quieras. O sea poder se puede.

      Eliminar
    3. Te informo que si juegas a los sims 3, también puedes cambiar de familia cuando quieras :l

      Eliminar
  22. -no quiero aliens en el juego base o generalmente
    -no me gustan las criaturas sobrenaturales, hace del juege sci-fi
    - me gustan los colores destacados e los entornos vivos
    - si, de acuerdo, me gustaría música similar de los sims 1 y 2 en la cuarta generación
    - si los bebes deben tener piernas y no solamente ser similar a una oruga
    - el modo coop me parece interesante, pero sería algo nuevo por los sims, como sería esto?
    - eso implica que nesecita támbien un modo online

    ResponderEliminar
    Respuestas
    1. Claro si añaden aliens que haya una opción como en Los Sims 3 de poder quitarlo.

      Igualmente nose porque os quejaís algunos (No digo que seas tu)
      de que haya una expansión de Criaturas Sobrenaturales o de que haya una criatura en el mismo juego base.

      Ya que si no te gusta no hace falta comprarlo nadie te obliga, y además en Los Sims 3 había opciones para quitar algun ser sobrenatural especifico.

      Eliminar
    2. gracias Paula por tu respuesta; no voy a quejarme de que haya criaturas o aliens si los anaden :-)

      Eliminar
  23. Dejando a un lado el profundo dolor que siente mi corazón por las críticas hacia los Sims 3 :'( Jejeje xD

    Para mí, hay algo que siempre me ha llamado la atención en el mundo de los sims (y aún más, tal y como se han puesto las cosas en la vida real) es la imperante utopía idílica en la que casi todo es felicidad y arco iris... xD
    No sé, creo que deberían pensar en ello para esta entrega quizás con una expansión que perfeccionaran temas como:
    - la delincuencia: mejorando la profesión política, policía y criminal. Que se puedan detener a los sims criminales y encarcelarlos; que los criminales pues puedan robar, atentar, e incluso asesinar a otros sims; que haya corrupción en los cargos políticos y los sims se preocupen y se manifiesten y voten a su alcalde y otras cosas que afecten al conjunto del vecindario (tipo simcity)
    - Desastres naturales ( no muy bestias para que no afecten mucho al rendimiento)
    - Temas sociales como el paro, y deshaucios (y por tanto que pueda a ver sims sin hogar y que tengan que buscarse la vida por los solares comunitarios). Se podrían incluir bancos para pedir créditos para comprar las cosas de los sims y haya hipotecas y tal (y así no tengamos que recurrir simplemente a los trucos tipo kaching o motherlode) xD

    No sé, ya sé que es un juego y que es para divertirse pero se supone que es un simulador social y tendría que incluir cosillas como estas para acercarse un poco más a la realidad, que además pueden ser perfectamente tratadas con el característico humor de los sims.
    Por supuesto, es sólo una idea, no sé si para el juego base o para una expansión pues habrá quien no quiera estas cosas, pero por otra parte tampoco son cosas de una temática concreta como para crear una expansión.. o quizás si?

    ResponderEliminar
    Respuestas
    1. Asesinar sims? Es un juego para todos las edades! xD Yo sé que aún quedan niños inocentes (?

      Eliminar
    2. Jajajajaja Sip, cuando lo leí también me sonó fuerte y la verdad no creo que lo de asesinar sims ni si quiera lo piensen, pues solo por incluir eso ya tendrían que subir la edad del juego de 12 a 18 y eso no compensa. Pero bueno, lo escribí porque, no seamos ingenuos ¿quién no ha matado a alguno de sus sims? xD Estoy seguro q hasta esos 'niños inocentes' también lo han hecho jajajaja

      Eliminar
    3. Niños inocentes que meten a sus sims en una pieza y borran las puertas y los matan JAJAJAJAJAJAJAJA yo hacía eso por favor. Vivimos en un mundo donde a los 5 años los chicos se drogan. Matar sims sería genial, a ver, no que aparezca y le clave un cuchillo y salte sangre y todo el tema, sería mejor que no sé, no sea taaaaaaaaan explícito, sino que en un robo, el criminal dispare y mate o hiera a uno sin la necesidad de ver sangre, y que caigan los policías y la ambulancia, y se lo lleven en camillas. Caes en shock de que esa es la realidad en la que vivis y te das cuenta de muchas cosas, sin perder el humor característico de los sims (:

      Eliminar
    4. Pues perdona que te diga pero esa clase de 'niños' que dices sera algunos
      porque yo de pequeña no pensaba así, y mi hermanito pequeño tampoco.

      Esa clases de personas son excepciones no todo el mundo es así.

      Y igualmente que haya asesinatos no lo veo muy... 'Aspecto Sims'
      Sin embargo un atraco sí (?) Muahahaha

      Eliminar
    5. Yo de niña me ponía a llorar si se me moría un sim (lo cual pasaba seguido, ya que a veces el juego se me iba de las manos xD). Un robo con muerte accidental está bastante bueno como dice irumercado, pero yo creo que las muertes deberían ser accidentales, como los meteoritos xD, o que cuando tienes un archienemigo y se peleen, accidentalmente uno muera *u*, ganaría obviamente el que tiene más habilidad física.

      Eliminar
    6. Lo de los atracos estaría genial! aunque obvio, en forma cómica como todo en Los Sims (iría en la calle y el ladrón le molestaría el hombro a la victima y tomaría su billetera y saldría corriendo (?)?

      En cuanto a que odio Los Sims 3... no es así, a mi me gustan, pero es que cuando hay algo mejor, y se puede algo mejor hay que exigirlo, nosotros somos lo que hacemos posible el juego indirectamente, ellos lo crean para nosotros, nosotros debemos aprobarlo :P aunque no todo, hay cosas de las que ellos saben más que nosotros.

      En cuando a la violencia, y drogas, me parece que todo lo "oscuro" de este mundo se debe eliminar de Los Sims, por que el juego también es un escape, y que nos ganamos si el mundo de ahí es igual a este?

      Eliminar
  24. LO UNICO QUE ME INTERESA AHORA ES COMO VAN A ASER LOS ANCIANOS LOS ADOLECSENTES, NIÑOS INFANTES Y BEBES, TAMBIEN LA CIUDAD !!!!!!
    ( ADEMAS CREO QUE CUANDO SE CONOZCA ESTO LA GENTE VA A CAMBIAR SUS OPINIONES, CREO... )

    ResponderEliminar
    Respuestas
    1. A mi me tiene preocupada también... ojalá que los niños sean un poco más monos (en Los Sims 3 daban yuyu, como que no eran demasiado adorables de aspecto).
      ¡Saludos desde Calatuña!

      Eliminar
  25. Pues, la verdad es que para mi, Los Sims 3 fue un exitazo, así como lo fueron sus versiones pasadas, asi que no creo que el juego se va a ir "a la ruina" como sugieres, y va a seguir cosechando éxitos como lo ha hecho hasta ahora :P Y aunque difiero muchísimo con tus opiniones respecto a Los Sims 3 (a mi me encanta el juego, creo que es una de las mejores versiones que se han hecho hasta la fecha respecto a jugabilidad), no puedo evitar estar tan de acuerdo contigo... Me encantaría que los Sims fueran así de dinámicos y cómicos como en Los Sims 2. Me encantaba!

    Para mi lo que se va a echar mas de menos va a ser el CASt. Recuerdo que mi carpeta de descargas colapsaba con tantos recolores xDDDDDD Aunque no hay que tener un sentimiento de derrota aún, pues todavía hay esperanza de que vuelva, tal vez no en el mismo juego base, pero si en una actualización de este. Suena algo trillado, pero puede pasar :P

    Sobre lo que yo quiero en el juego... vaya, dificil, pues tengo ideas, y son MUCHÍSIMAS... Varias de ellas aparecen en este mismo post xDDD Sigo pensando en que un modo cooperativo online sería FANTASTICO. Es una de las cosas que mas he deseado desde que juego Los Sims, y viendo las posibilidades de jugabilidad online a las que se han expandido los juegos que han salido este ultimo tiempo, por qué Los Sims 4 no puede tomar ese paso en algún momento? Eso si, no quiero que por eso se torne en un juego que tenga que tener una conexión de internet persistente como en Simcity... lo disfruto muchísimo, pero ese fue el peor fallo que Eaxis ha cometido con el juego :'c (Por lo que tengo claro, está confirmado que Los Sims 4 se va a poder jugar offline, pero bueeeeeeeeno... solo decía (?) )

    También me encantaría que se pudiera hacer lo de visitar otros barrios :P Con tantos barrios en Los Sims 3 que salían con cada expansión y en la Store yo creo que todos los fans del juego esperabamos que se pudiera hacer eso, sin la necesidad de tener que mudarte de tu barrio actual para hacerlo (Especialmente con Aventura en la Isla! De que me sirve quedarme en un hotel si no puedo viajar? >_< Aunque agradezco que se haya agregado esto al juego, me he divertido bastante cambiando a mis familias de barrio. También estaría bueno que lo agregaran al juego base de LS4. APARTE de lo de viajar, claro está)

    Lo que también me gustaría ver en LS4 es justamente lo que tu dijiste, que los barrios se pudieran hacer así de facil como en Los Sims 2 sin la necesidad de una herramienta TAN complicada como la de "Crear un Mundo". Se echó muchísimo de menos en Los Sims 3... eso si, me gustaría que la herramienta de "Crear un Mundo" volviera para LS4, pero SOLAMENTE para hacer los mapas de terreno bases para después importarlos al juego y poder poner las casas y edificios en el mismo juego :P Y como no, que se pudieran exportar los barrios desde el juego de LS4 para poder compartirlos como descarga.

    Para terminar: Quiero que en LS4 mis Sims vuelvan a tener la opción de escogerles ropa interior, y sí, QUIERO UN "ABREN NEGOCIOS" PARA LS4! He dicho!

    Y esa fue mi humilde opinión :P Muchas gracias por su atención (?)

    ResponderEliminar
    Respuestas
    1. Los Sims 3 no fue un éxito, como lo dices, no comparando con los otros juegos de la saga, los números lo dicen... Sims 1, 16 millones, Sims 2, 20 millones y Sims 3, 10 millones. Si, el juego fue genial! como todo lo de Los Sims, pero no fue lo mejor que pueden hacer, y ellos mismos lo reconocen.

      De resto estoy de acuerdo contigo :D

      Eliminar
  26. Mis fantasias u_u no son tan locas jaja dudo que las cumplan...

    Transportes públicos mas reales, mas variados. No solo subtes que parecen agujeros negros y taxis que aparecen misteriosamente. ¡Quiero estaciones, trenes -SOBRETODO TRENES-, colectivos, que esto afecte al humor de los sims -que si hay mucha gente se sienta molesto, que se quedo dormido y se paso una estación xD-

    Mas interacciones para los negocios y no solo una caja registradora y ya. Estaría interesante que hubiese mas interacciones -como locales de ropa donde los sims puedan pedir opiniones, sufrir robos, lidiar con clientes fastidiosos. O si es un resto que ademas del chef tenga meseros, mas clientes -por sobre todo xD-

    Religiones o-o jaja yo soy atea pero me parecería genial que los sims tuviesen religión y de acuerdo a su religión se le agregaran obligaciones, fiestas, que puedan ir a la iglesia, etc.

    Ame la idea de visitar parientes de otros barrios, aunque me conformo que cuando se muden no se corten las relaciones xD

    ResponderEliminar
    Respuestas
    1. Religión? En un juego de los sims? JA! Sabes qué pasó con el pack de accesorios de navidad los sims 2 simplemente? :P
      Recibieron millones de críticas por simplemente añadir ese pack de accesorios xD

      Eliminar
    2. Que me perdido? QUE PASO? CON ESE PACK SI ERA MUY CHULO! :ooo
      LES MATARE LOS Q PENSARON NEGATIVAMENTE!! >:C

      Todo el mundo tiene derecho a creer en algo.
      Además se podrían inventar un Dios Sim? XD

      Eliminar
    3. con eso de las religiones estoy de acuerdo pero que se pudiera elegir entre varias

      Eliminar
    4. A mi me encantaría eso de las religiones, pero bueno. También las tumbas del cementerio (no todas) iban a ser cruces y terminaron siendo normales (en los sims 3) Por cierto, en el juego, el jugador se considera el dios xD

      Eliminar
    5. Que hubiera varias religiones y que tengan dioses asi bien locos xD en eso pensé mas que nada, añadiría algo diferente al juego y creo que seria divertido.

      Eliminar
    6. Las religiones me parecen buena idea, pero unas obviamente inventadas, y podrían ser basadas cómicamente en las que existen en el mundo, o totalmente nuevas, pero nunca como lo son en realidad, eso sería cataclismo :P

      Eliminar
  27. Bien, vengo a fantasear yo tambien. Algo que siempre (S-I-E-M-P-R-E) quise fue poder entrar al negocio. Es decir, mandas a tu sim a comprar libros y el va, entra, se cierra la puerta y te sale el panel con los libros para comprar-vender. Pero TÚ nunca entras al lugar, entiendes? Me gustaría poder entrar, que revise estanterías y cosas así, tipo biblioteca, entiendes? O CUANDO VAN AL CINE! Poder entrar junto a tu sim y su cita (o amigos/familia) poder ver la boletería, mandarlo allí, que te salga el panel de las películas, elegirla, poder elegir donde sentarse y todo el tema. Cuando esten sentados y comiendo, que tu tambien puedas ver esa película y puedas tener interraciones, osea, si estas con tu cita, poder besarla en la película, o si estas con amigos, tirarle pochoclo a la gente (cosa que yo hice con una amiga :P ) Sería divertido (: o cuando los mandan a la carcel, poder entrar tambien. Esas cosas. Me gustaría que no solo los que tienen el juego original puedan acceder al CAW, bc, traté de descargarlo y no pude :(( y gente pobre como yo que pirateamos todo queremos el CAW :(( Y eso de poder conectarte tipo en línea y poder jugar junto a tus amigos sería algo fantástico, lo amaría. PEEEEEEEEEEEEEEEEEEEEEEERO, me gustaría que esa pasara en un mundo aparte, es decir, tener un mundo donde poder encontrarte con tooooooooooda la gente, y tener OTROS mundos apartes que sean personales, donde solo vos sos el que jugas, así si queres editar tu mundo, lo haces vos, y no que 50 personas no les agrade. Me gusta la idea de publico-privado, entiendes? bue, como si fueras a leer esto JAJAJAJAJAJAJAJA.

    En fin, amo esta página, sube más cosas para descargar, tipo ropa, maquillaje, peinados, etc etc sería kul. Un beso enorme desde Argentina y gracias por todos los post que nos ayudan más de lo que crees, adiós (:

    ResponderEliminar
    Respuestas
    1. Gracias :D!!! el contenido personalizado, subiremos más, pero no esa clase, si no Sims y casas y eventualmente alguna otra cosa especial.

      De acuerdo a lo que dices, eso pasaba en Los Sims 2 (algo parecido) ibas al supermercado, y veías todo! en Los Sims 4 si se hace eso supongo sea en otro nivel!

      Eliminar
  28. A Sarah amo a baseada no The Sims 2 <3 https://twitter.com/SimGuruSarah/status/440590903598526464

    ResponderEliminar
  29. Opino igual en la gran mayoría, por no decir todo, e inclusive comentarios.
    Sobre todo en lo de que algunas expansiones deberían venir ya en el juego base, quiero decir, en Los Sims 3 se hicieron expansiones para las mascotas y para las estaciones, cuando eso ya lo conocíamos de Los Sims 2 (en el caso de las mascotas desde Los Sims 1) y repetir lo mismo no me parece plan. Claro que quiero que haya mascotas y estaciones, pero desde el juego base, no como un contenido aparte que ya conocemos. Las demás expansiones que salieron en Los Sims 3 muchas de ellas se daban ya en Los Sims 2 o incluso en Los Sims 1, pero no me parecen tan imprescindibles como podrían ser las mascotas, el clima o una mayor interacción entre los miembros de la familia (como en Menuda Familia). Que conste que sí me gustaron Los Sims 3 y eso que al principio fui un poco reacia a probarlos. xD
    Totalmente de acuerdo también en cuanto una mayor reducción de madrigueras y que se siga manteniendo el mundo abierto. Además, asimismo que pudiera haber un online o que los sims puedan ir a diferentes barrios como se ha comentado, con ello por mi parte ya sería una compra asegurada sí o sí.
    Sigue dándome un poco de pena el que no vayan a haber diferencias de altura, pero bueno. :/

    Por el momento no se me ocurre nada para añadir, mis ideas son prácticamente las mismas a las expuestas (incluso en el apartado sobre los Magia Potagia y el Superstar).^^

    ResponderEliminar
  30. en el juego base si vienen tres mundos uno deberia de ser similar a sunset valley otro a bridgeport pero viendose todo el edificio no solo tu casa y el tercer mundo un archipielago como isla paradiso

    ResponderEliminar
  31. deberian de añadir mas postres por ejemplo flan, natillas, etc. y tambien que tus sims puedan comerse tentempies como patatas fritas, pipas, etc.

    ResponderEliminar
  32. Estoy TOTALMENTE de acuerdo contigo.

    ResponderEliminar
  33. Me emocionaste con lo de los barrios. XD

    ResponderEliminar
  34. ¡Hola!
    A mi la verdad no me atrae tanto la version online... supongo que es porque mis amigos no juegan a los sims (ñ.ñ), pero creo que es un jugo para uno, aunque si hay gente a la que le apetece... ¡adelante!
    Param mi lo que Juan ha dicho está bien, pero aunque suene una tonoteria... me ENCANTARIA que hubiera habilidad de afeitado ^_^ Jejejejeje, suna a chorrada sin importancia, pero para mi seria genial que se afeitaran, creo que seria un punto a favor del realismo y que, además, haria que se estrecharan los lazos con tu sim adolescente (por ejemplo: tu sim acaba de llegar a la etapa adolescente y le empieza a crecer barba (eso requiere que crezca barba, claro...) y tiene que afeitarse... primera pasada y... Corte! Y ale, al instituto con marcas de afeitado en la cara).
    Supongo que esto no lo van a leer, y que, por consiguiente, no va a estar agregado, pero seria bueno...

    Me gustaría también que hubiese etapa pre-adolesente, porque eso de que pasen de ser unos pequeños sims con una coronita de carton encima de una mesa jugando a ser reyes a unos sims que conducen y se besan... pues como que es un poco repentino, ¿no? En la etapa pre-adolescente yo los haría... pues un pelín más altos que de niños. Que se interesaran por los chicos y SOLO llegaran al coqueteo, las bromas coquetas, etc.
    A mi parecer no son necesarios los aliens, nunca juego con ellos y tampoco no me atraen... no se, si hay tanta gente que los desea pues que los agreguen, pero que tenga opcion de deshabilitarlos (¡plis plis plis plis plis!).
    Por mi que los infantes sean un poco mas... interactivos (no sé como llamarlos).
    Y lo IMPRESCINDIBLE (bueno, es prescindible, si, pero es importate): que el cine NO sea una madriguera. Que se pueda interactuar, quiero decir. por ejemplo: estas con tu cita y decides besar-la y si es de miedo darle la mano o no se. Y que se pudiese hacer lo mismo en los estadios.
    También estaía bien que volviera el citómetro (el medidor de calidad de las citas), creo yo...
    Jejejeje, son todo opiniones, no creo que Eaxis se tome a molestia de pasarse por alguna de estas webs y precisamente mire mi comentario, asi que todo eso son fantasias.
    ¡Saludos desde Cataluña!

    ResponderEliminar
    Respuestas
    1. Se me olvidó... que cunado hagan la expansión de las estaciones, que haya una opción de "cedir la chaqueta", que queda muy romántico y siempre la he querido en mi juego (para hacer historias bonitas, como de peli). ^_^

      Eliminar
    2. ¡Me encanta mucho tu comentario!
      No es que comparta las mismas ideas... (Algunas sí :D)
      pero sabes pensar en los demás.
      (Lo de la chaqueta si que quedaria romántico *-*)

      Y por cierto alomejor si que agregan lo de el pelo y la barba ya que enrealidad ellos mismos lo casi confirmaron pero dijeron que estaba
      'mal traducido'. (Así que cruzar dedos)

      Y por fín POR FÍN alguien dice no me gusta los aliens pero si la gente lo quiere pongan un botón de deshabilitar POR FIN (A mi si me gustan XD)

      Eliminar
    3. Supuestamente no habrán tantas madrigueras, según dijeron. Esperemos que el cine sea una de esas tantas madrigueras que desapareceran *-*. Yo por mi parte quisiera que el crecimiento sea gradual y que en vez de elegir entre "infante-niño-adolescente-adulto joven- adulto- anciano" se pueda elegir una edad específica, cuando estás creando al sim, y que se adecue a una etapa d e la vida y a una estatura la estructura del sim. Aunque mi idea requeriría cambiar el tiempo sim y sus cumpleaños x.x. Pero no es mala idea eh (?) >.<.

      Los extraterrestres siempre fueron mi pasión, en LS2 me encantaba subir la lógica y hacer una torre mega alta con un telescopio para hacer contacto. Los bebés salían preciosos xD. Lamentablemente eso no lo pude disfrutar en LS3 y es algo que le sacó el toque Sims.
      Las citas de LS2 son hermosas, me gustarían que volviesen, obviamente con más opciones para con el sim invitado.

      Y esperemos que el crecimiento del cabello sea real :DD

      Eliminar
    4. Las citas en los sims 2 con el medidor eran fantásticas yo también quiero que vuelvan, lo de pasar la chaqueta estaría muy bueno y el cine sin madriguera seria genial, que nuestro sims pudiera comprar pop-corn o use los anteojos 3D y le de algun estado de humor (inclusive que exista una muerte x 3D tipo que salga un meteorito de la pantalla y mate al sims XD)y que la peli dure mas que en el cine de la store (dura 30 minutos creo) ,también que vuelva el sistema de atracción de "me pone-me corta" del sims 2

      Eliminar
    5. Me encantan todas las fantasías! se que he respondido algo tarde, pero los leía justo cuando lo publicaban XD todos esos pequeños como lo de la chaqueta y afeitarse serían geniales, y no es que agregue o quite mucho, pero eso cambia radicalmente el juego uno en uno!

      Lo de la revista de España, la verdad es muy incierto, hay cosas que no podrían estas con mala traducción... digo, hay palabras iguales pero es imposible que todo lo que dijeron esté mal.

      Yo creo que al final las madrigueras serán, las del trabajo, el hospital, y la cárcel (siendo también del trabajo). Los negocios deben ser totalmente abiertos, o he pensado en que sean sub-abiertos (pero eso incluíria todo), con habitaciones negras pero pasillos destapados, como decir el hospital se le ve la zona de espera, pero la sala de operado está obvio bloqueada, y es como una habitación madriguera :P

      Eliminar
  35. "Magia Potagia supera a Criaturas Sobrenaturales" NUNCA, pero NUNCA en mi vida estuve más de acuerdo con eso. Aunque me gustó la expansión de Los Sims 3 y estoy conforme con ella, la verdad prefiero mil veces los objetos y la magia de Magia Potagia, eran muy divertidos y variados.

    ResponderEliminar
  36. Leyendo lo de que perdiste el interés hace mucho en Los Sims 3, me alegré bastante porque yo también lo perdí, pero pensé que había perdido el gusto por Los Sims xDD Sigo jugando a Los Sims (1) y siempre me divierto bastante. Los gráficos de Los Sims 4 me encantaron porque no eran tan realistas como para hacer al juego más lento, y también sería más fácil la creación de expansiones sin que hayan tantos bugs. A mi parecer en Los Sims 3 el realismo que tienen los gráficos es una limitación a la creación de contenido. Si fueran más caricaturescos, sería más rápido crearlos y así se podrían añadir más contenido y variedad.

    ResponderEliminar
    Respuestas
    1. Si! claro, creo que esa es la idea principal de el nuevo estilo de arte, que el juego sea mucho más abierto! y es que en un simulador de la vida se le debería poder agregar cualquier cosa imaginada...

      Eliminar
  37. OMG yo también quiero ir al espacio *__*

    ResponderEliminar
  38. El sims 3 tiene muchos bugs, a mi me puso un pelo de niña a un niño, y de pijama el atuendo de la parca...

    ResponderEliminar
  39. Felicidades por tu blog y por este articulo, la espera se hace asi menos monótona y se agradece el trabajo!!

    ResponderEliminar
    Respuestas
    1. Gracias ^^ me alegra que te haya gustado el artículo.

      Eliminar
  40. No puedo estar más de acuerdo contigo. Especialmente en lo de cambiar la mecánica del juego, me encantaría poder jugar a Los Sims en primera persona como alternativa, siempre he pensado que sería un buen punto y le daría mayor "inmersión" al juego. Por no hablar de cómo sería esta hipotética primera persona con Oculus Rift jajajaja

    Aunque realmente no creo que lo implementen en ningún momento cercano, es una pena, pero bueno. Esperemos llegar a verlo al menos algún día.

    Gran trabajo, por cierto :)

    ResponderEliminar
    Respuestas
    1. Si :/puede que no lo implementen, pero.... siempre están los Sims de consola para hacerlo? XD

      Eliminar
  41. DIOS! YO AMABA LO DE PODER HACERSE FOTOS EN LOS SIMS 1 CON UN FONDO Y TODO ESO!!!!!!!!!!!!!!!!!!!!!!!!!!

    ResponderEliminar
  42. QUE VUELVAN LAS "cinemáticas" PERO ,AHORA APARECIERAN CUANDO traicionan,celos XD ....y cuando se van a transformar en bruja, zombie ,hombre lobo....SERIA SUPER ULTRA IPER MEGA guuaaauuauuauauuauauaua :D

    ResponderEliminar
  43. He jugado a Los Sims 3 creando generaciones de familias y he llegado a casarlos entrre ellos como sucede en la vida real. Pero he visto que no hay necesidad de que el juego cree mas sims aleatorios si yo estoy creando sims, acepto la funcion de progresión de la historia pero con mis sims creados NO ESO DE AÑADIR SIMS NUEVOS AL BARRIO sobrecarga la partida y pierde el juego. Absolutamente deacuerdo con eso de poder ir a otros barrios normal como en Los Sims 2, pero repito aclaro que se inicie la partida con las unidades domésticas que quiera pero eligiendo muy pocas no mas de 5 y no menos de 2 por ejemplo. ESO de "unidad domestica activa" NO SIRVE

    ResponderEliminar
  44. Modo Coop? Eso seria una novedad? Con lo guapa que es Pau imagínate el montón de sims :)

    ResponderEliminar
  45. •Estaria bueno que en el juego base de los sims 4 pudieran haber climas diferentes... como en la expancion de "las cuatro estaciones" ya que es algo aburrido tener siempre lo mismo...ademas seria algo mas realista..!
    •Tambien me gustaria que se puedan comprar los reproductores de mp3,videojuegos y moviles como en los sims 2 no como en el sims 3 que ya venia incluido con el sim el movil...!

    ResponderEliminar
  46. Que se permita escoger pocas unidades domesticas, 2-5

    ResponderEliminar
  47. me equivoco o las chicas en LS4 son mas... planas??????????????

    ResponderEliminar
  48. Enserio, deberían volver a integrar la saga de Simcity con The Sim 4 mínimo ganarían mucho!!!

    ResponderEliminar
  49. Total mente de acuerdo y en especial hago incapie en los sims abren negocio, eso lo extrañe muchisimo en los sims 3(Me volvi a pasar a los sims 2 hace unos dias porque aunque es cierto que lo del mundo abierto y la personalizacion de los objetos en los sims 3 es algo muy bueno, los sims 2 aun me hacen morirme de risa)otra cosa que extrañe es el tema de los hobbies. si existia la fabrica de robots, en los sims tres el chatarratronic, yo mne divertia mucho haciendo jarrones y ropa, o jugetes y robots (las flores me aburrian un poco) o arreglando autos, y luego abastecia mi negocio de estas cosas. y en los sims 3 lluve demasiado en todas las estaciones. otra cosa que me gustaba eran las brujas en sims 2 los hechizos eran mucho mas divertidos, aunque las hadas estaban buenas

    ResponderEliminar
    Respuestas
    1. Si! de acuerdo contigo en todo, yo también me pasé a Los Sims 2! :D

      Eliminar
  50. no puedo eliminar mis coments viejos QUE HAGO? Ya me callo ok :)

    ResponderEliminar
  51. Me encantó tú artículo! :D!

    Porque no se lo pones a los SimGuru tus ideas, en Twitter o en algún medio? Así ellos lo verán y les darás más ideas. :D!

    ResponderEliminar
    Respuestas
    1. Muchas gracias! me alegra que te haya gustado, en cuanto a lo del SimGuru, una de ellos visitó la entrada, y afirmó que le gustaba la portada inspirada en Los Sims 2, pero no dijo nada más! igual no creo que haya leído algo, pero si sería genial que alguien se lo enviara a Graham por ejemplo :P

      Eliminar
  52. Creo que Los Sims 3 no es tan malo, sólo que es muy potente y...¡Tiene bugs!
    Eso es lo único malo que le veo, en mi caso tengo un ordenador medianamente bueno y me va bien :P
    Otra cosa es que el sims 4 podría ir inspirado en sims 2.

    ResponderEliminar
  53. y nadie dice nada de las escaleras?? tener que subir terreno, tirar de trucos... para poder poner escaleras modulares! y aún así no quedan del todo bien...
    tendrían que permitir que las escaleras se pudieran colocar en módulos, poder partirlas y cambiar de dirección.

    ResponderEliminar
  54. Bueno, y lo de la estatura es algo que lo vengo diciendo desde el inicio! poder elegir la estatura del sim al crearlo, que hayan sims más bajitos y más altos. Y que vayan creciendo con la edad (cuando son niños obvio! no de adultos)
    Y otra cosa... podrían tener accidentes, en el trabajo, en el coche, que el coche se les estropee y lo tengan que llevar a un taller... que hayan sims con sillas de ruedas... no sé... más realista!! que no sea un "mundo perfecto"...

    ResponderEliminar
  55. Justamente pensaba lo mismo que vos en varias partes..primero que deseo volver a ver la camara de efectos especiales en los sims 2...eso me haria muy feliz y se que a muchos simmers tmb.....ahora yo me plantie la misma duda que vos con respecto a las edades...acaso ya no posee la genetica en los sims 4? acaso ya no habra embarazos, bebes, infantes,niños, adolescentes, etc?.....esta duda me vino a la mente cuando salio el video donde crearon a homero y elvira lapida, cuando empieza a crear a homero me extraño el que le agrara los detalles de las arrugas para que "parezaca" mayor, primero pense debe ser simplemente una caracteristica estetica pra agregarle algo de realismo al rostro del personaje, pero enseguida me empece a desesperar cuando pense en la posiblidad de que sean como el sims 1, que no haya avance de edad ni genetica, y eso me desespero porque seria vovler demaciado atras y espero que me equivoque porque seria una gran lastima si cometen ese gravisimo error

    ResponderEliminar
  56. Lo que amaba de los sims 2 eran las historias, amo Vista Gentil, jugar con cada una de las familias era una mini historia que se conectaba con otras, LOS RECUERDOS!!! oh dios, como los amaba! me gustaria que pusieran un poco mas de misterio, seria perfecto...

    ResponderEliminar
  57. A mi me gustaría poder viajar al espacio en los sims 4. Concocer otras razas y construir nuevas colonias en otros planetas. También me gustaría que hubieran guerras.

    ResponderEliminar
  58. A también un modo multijugador

    ResponderEliminar
  59. varias cosas de los otros sims deverian estar en los juegos nuevos ¿no? ya que el juego se va mejorando habria que ponerlo digo yo

    ResponderEliminar
  60. a mi me encantaria que los sims hicieran karate, gimnasia ritmica,basquet,futbol o algun otro deporte

    ResponderEliminar